View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18465_high_22 (Length: 279)
Name: NF18465_high_22
Description: NF18465
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18465_high_22 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 134; Significance: 8e-70; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 134; E-Value: 8e-70
Query Start/End: Original strand, 16 - 184
Target Start/End: Original strand, 14710691 - 14710862
Alignment:
| Q |
16 |
cacttgccacagaaaaaacacccaaaccattttcaggctaaattcttatatcagcttcaagatcctcagagagatggtagagcttcagaccctttaagaa |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| | || |||| |||||||||| |
|
|
| T |
14710691 |
cacttgccacagaaaaaacacccaaaccattttcaggctaaattctaatatcagcttcaagatcctcagagagatggtaaaactgcagatcctttaagaa |
14710790 |
T |
 |
| Q |
116 |
aaactta---cttaaggtccaaaaaagatacgtcttccacaagctgcgtaacacatgcataactgattaaat |
184 |
Q |
| |
|
||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14710791 |
aaacttattgcttaaggtccaaaaaagatacgttttccacaagctgcgtaacacatgcataactgattaaat |
14710862 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University