View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18465_high_26 (Length: 206)

Name: NF18465_high_26
Description: NF18465
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18465_high_26
NF18465_high_26
[»] chr8 (1 HSPs)
chr8 (17-184)||(560170-560337)


Alignment Details
Target: chr8 (Bit Score: 148; Significance: 3e-78; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 17 - 184
Target Start/End: Complemental strand, 560337 - 560170
Alignment:
17 agcaaaggcatagttgtaaaggaagaactggctaatattataaagggtatcatggagggtttggaaagtggagaaattcgaagaagaatgaaagaactac 116  Q
    |||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||    
560337 agcaaaggcatagtggtaaaggaagaagtggctaatattataaagggtatcatggagggtttggagagtggagaaattcgaagaagaatgaaagaactac 560238  T
117 aaaggtttgctaattgtgctattatggaaaatggatcatccatgaagaccttttctctgttggcactt 184  Q
    ||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||    
560237 aaaagtttgctaattgtgctattatggaaaatgggtcatccatgaagaccttttctctgttggcactt 560170  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University