View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18465_high_26 (Length: 206)
Name: NF18465_high_26
Description: NF18465
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18465_high_26 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 148; Significance: 3e-78; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 17 - 184
Target Start/End: Complemental strand, 560337 - 560170
Alignment:
| Q |
17 |
agcaaaggcatagttgtaaaggaagaactggctaatattataaagggtatcatggagggtttggaaagtggagaaattcgaagaagaatgaaagaactac |
116 |
Q |
| |
|
|||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
560337 |
agcaaaggcatagtggtaaaggaagaagtggctaatattataaagggtatcatggagggtttggagagtggagaaattcgaagaagaatgaaagaactac |
560238 |
T |
 |
| Q |
117 |
aaaggtttgctaattgtgctattatggaaaatggatcatccatgaagaccttttctctgttggcactt |
184 |
Q |
| |
|
||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
560237 |
aaaagtttgctaattgtgctattatggaaaatgggtcatccatgaagaccttttctctgttggcactt |
560170 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University