View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18465_low_26 (Length: 245)
Name: NF18465_low_26
Description: NF18465
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18465_low_26 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 184; Significance: 1e-99; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 20 - 235
Target Start/End: Original strand, 24698493 - 24698708
Alignment:
| Q |
20 |
gacaacgttaaaaagggaaagtgcaagagtgtgaagaaattattacaaacttatccaagaggcataatgtcaaaacatattataaaatgcatgaaggaaa |
119 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||| |
|
|
| T |
24698493 |
gacaacgttaaaaagggaaagtccaagagtgtgaagaaattattacaaacttatccaagaggcataatgtcataacagattataaaatgcatgaaggaaa |
24698592 |
T |
|
| Q |
120 |
atgagaaatcactaagcatccaaggcattcgggtgtgaggttccagcgtcatttgggttgggaaaaggaaaggcataaaaggaactaggtgagcatccta |
219 |
Q |
| |
|
|||||||||||||||||||||| |||||||| ||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24698593 |
atgagaaatcactaagcatccagggcattcgtgtgtgaggttccatcgtcatctgggttgggaaaaggaaaggcataaaaggaactaggtgagcatccta |
24698692 |
T |
|
| Q |
220 |
ggttatcccacctatg |
235 |
Q |
| |
|
||||||| |||||||| |
|
|
| T |
24698693 |
ggttatctcacctatg |
24698708 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 87; E-Value: 8e-42
Query Start/End: Original strand, 129 - 235
Target Start/End: Original strand, 24689263 - 24689369
Alignment:
| Q |
129 |
cactaagcatccaaggcattcgggtgtgaggttccagcgtcatttgggttgggaaaaggaaaggcataaaaggaactaggtgagcatcctaggttatccc |
228 |
Q |
| |
|
||||||||||||| || ||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24689263 |
cactaagcatccagggaattcgtgtgtgaggttccagcgtcatcagggttgggaaaaggaaaggcataaaaggaactaggtgagcatcctaggttatccc |
24689362 |
T |
|
| Q |
229 |
acctatg |
235 |
Q |
| |
|
||||||| |
|
|
| T |
24689363 |
acctatg |
24689369 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University