View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18466_high_13 (Length: 341)
Name: NF18466_high_13
Description: NF18466
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18466_high_13 |
 | |
|
| [»] scaffold1364 (1 HSPs) |
| | |
|
| [»] scaffold0351 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold1364 (Bit Score: 153; Significance: 5e-81; HSPs: 1)
Name: scaffold1364
Description:
Target: scaffold1364; HSP #1
Raw Score: 153; E-Value: 5e-81
Query Start/End: Original strand, 34 - 299
Target Start/End: Complemental strand, 719 - 460
Alignment:
| Q |
34 |
gaatttggaatttgagactctttaatctagccgttcttggtaaatggtggtggacagtgaagatatagactgattaatcatggaaattggttctaaagca |
133 |
Q |
| |
|
||||| ||||||||||| ||||||| |||| | ||||||||||||||||||||| |||||||||| | || ||||||| || |||||||||||||||||| |
|
|
| T |
719 |
gaattaggaatttgagattctttaacctagtccttcttggtaaatggtggtggagagtgaagatacataccgattaat-attgaaattggttctaaagca |
621 |
T |
|
| Q |
134 |
aaaatattgtcatagattggagatgataaataaaaatacttctttgtggtggagagatttgaagtcttgtgctagcttatcggggtaggggtggggtagg |
233 |
Q |
| |
|
||||||| ||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||| ||| |||| ||||||| |||||||| |
|
|
| T |
620 |
aaaatatggtcatagattggagatgataaataagaatacttctctgtggtggagagatttgaagtcttgtgttagtttat-tgggtaggagtggggta-- |
524 |
T |
|
| Q |
234 |
ttggttggtttgatgagaatttaagaatagaagttggagacgggaaaaatgctagattttggtcgg |
299 |
Q |
| |
|
|||||||||||| |||||||||||| ||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
523 |
--ggttggtttgataagaatttaagaaaagaagttggagacgggaaaaacgctagattttggtcgg |
460 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 133; Significance: 4e-69; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 133; E-Value: 4e-69
Query Start/End: Original strand, 75 - 239
Target Start/End: Complemental strand, 33600372 - 33600209
Alignment:
| Q |
75 |
aaatggtggtggacagtgaagatatagactgattaatcatggaaattggttctaaagcaaaaatattgtcatagattggagatgataaataaaaatactt |
174 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
33600372 |
aaatggtggtggacagtgaagatatagactgattaattatggaaattggttctaaagcaaaaatattgtcatagattggagatgataaataagaatactt |
33600273 |
T |
|
| Q |
175 |
ctttgtggtggagagatttgaagtcttgtgctagcttatcggggtaggggtggggtaggttggtt |
239 |
Q |
| |
|
|||| ||||||||||||||||||||||||| ||||||||| |||||| |||||||||||||||| |
|
|
| T |
33600272 |
ctttctggtggagagatttgaagtcttgtgttagcttatc-tggtaggagtggggtaggttggtt |
33600209 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0351 (Bit Score: 107; Significance: 1e-53; HSPs: 1)
Name: scaffold0351
Description:
Target: scaffold0351; HSP #1
Raw Score: 107; E-Value: 1e-53
Query Start/End: Original strand, 116 - 299
Target Start/End: Complemental strand, 11731 - 11553
Alignment:
| Q |
116 |
gaaattggttctaaagcaaaaatattgtcatagattggagatgataaataaaaatacttctttgtggtggagagatttgaagtcttgtgctagcttatcg |
215 |
Q |
| |
|
||||||||||||||||||||||||| |||||||| |||||||| ||||||| ||||||||||||||||||||||||||||||||||||| ||| ||||| |
|
|
| T |
11731 |
gaaattggttctaaagcaaaaatatggtcatagactggagatgttaaataagaatacttctttgtggtggagagatttgaagtcttgtgttagtttatc- |
11633 |
T |
|
| Q |
216 |
gggtaggggtggggtaggttggttggtttgatgagaatttaagaatagaagttggagacgggaaaaatgctagattttggtcgg |
299 |
Q |
| |
|
||||||| |||||||| |||||| ||||| |||||||||||| |||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
11632 |
gggtaggagtggggta----ggttggcttgataagaatttaagaaaagaagttggagatgggaaaaaccctagattttggtcgg |
11553 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University