View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18466_high_16 (Length: 292)
Name: NF18466_high_16
Description: NF18466
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18466_high_16 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 267; Significance: 1e-149; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 267; E-Value: 1e-149
Query Start/End: Original strand, 1 - 287
Target Start/End: Original strand, 21416290 - 21416576
Alignment:
| Q |
1 |
gtcttcgccttggctgttcctgctttgtcgcacttttttctagcatgtgaagattgtgatgcgagacattcgagaccgtatgattctgttgttcagattt |
100 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21416290 |
gtcttcgcattggctgttcctgctttgtcgcacttttttctagcatgtgaggattgtgatgcgagacattcgagaccgtatgattctgttgttcagattt |
21416389 |
T |
|
| Q |
101 |
cgttgagttctgttgcggtgttgtcgtttttgtgtttgtccacgtttgtgaagaagtatgggttaaggaggtttttgtttttggataagctttgtgatga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| || |||||||||||||||||||||||||||||||| |
|
|
| T |
21416390 |
cgttgagttctgttgcggtgttgtcgtttttgtgtttgtcgacgtttgtgaagaagtatgggttgagaaggtttttgtttttggataagctttgtgatga |
21416489 |
T |
|
| Q |
201 |
aagtgaaaatgttagaatgaactatatggttcagctcaatgtgagttttcttctatctacctcttcagcttgctctgtttctctgtt |
287 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21416490 |
aagtgaaaatgttagaatgaactatatggttcagctcaatgtgagttttcttctatctacctcttcagcttgctctgtttctctgtt |
21416576 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University