View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18466_high_20 (Length: 244)
Name: NF18466_high_20
Description: NF18466
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18466_high_20 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 136; Significance: 5e-71; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 136; E-Value: 5e-71
Query Start/End: Original strand, 66 - 226
Target Start/End: Original strand, 4951704 - 4951868
Alignment:
| Q |
66 |
gatgacggatcatatgggtccatgtgatttaaatttgatagttgaaaactaat----taatttacgaaacatcttggacccaccatggattttgtgatct |
161 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||| |||||||||||||| ||||||||||||| |
|
|
| T |
4951704 |
gatgacggatcatatgggtccatgtgatttaaatttgatagttgcaaactaattaattaatttacgaaacagcttggacccaccatagattttgtgatct |
4951803 |
T |
 |
| Q |
162 |
ccttgctaatctggtaatcgttttaaaatagtgtacatcaatttcttctagagctgtggtctgtg |
226 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4951804 |
ccttgctaatctggtaatcgttttaaaatagtgtacatcaatttcttctagagctgtggtctgtg |
4951868 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University