View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18466_high_25 (Length: 222)
Name: NF18466_high_25
Description: NF18466
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18466_high_25 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 179; Significance: 9e-97; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 179; E-Value: 9e-97
Query Start/End: Original strand, 18 - 208
Target Start/End: Original strand, 37218590 - 37218780
Alignment:
| Q |
18 |
ggatttgtgtacttgttgtaagacatgagcttgatgttggttgctcaaaccatccagacaagtttctccattaatgtcattcaattcgacatcacatagg |
117 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
37218590 |
ggatttgtgtacttgttgtgagacatgagcttgatgttggttgctcaaaccatccagacaagtttctccattaatgtcattcaattcgaaatcacataga |
37218689 |
T |
 |
| Q |
118 |
tttattatttgatcatagagtggcaaactagctcttgcacgtttctttgttcttatattatggtagttatctatctcatttcctcttcttc |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37218690 |
tttattatttgatcatagagtggcaaactagctcttgcacgtttctttgttcttatattatggtagttatctatctcatttcctcttcttc |
37218780 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University