View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18467_high_24 (Length: 417)
Name: NF18467_high_24
Description: NF18467
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18467_high_24 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 130; Significance: 3e-67; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 130; E-Value: 3e-67
Query Start/End: Original strand, 175 - 324
Target Start/End: Original strand, 12607583 - 12607732
Alignment:
| Q |
175 |
aattctgtttcttatgtgtctaactaacatgcttctgagccctcacatctttcttcccctcccctctggccaacacctctagcctgtcggacgtatttgg |
274 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| || |||||||||||||||||||||||||||||||||| |
|
|
| T |
12607583 |
aattctgtttcttatgtgtctaactaacatgcttctgagcccccacatctttcttcccctcctctttggccaacacctctagcctgtcggacgtatttgg |
12607682 |
T |
|
| Q |
275 |
ccaaatagctacttgagttctatacgttcggcttgatcaattatggttgc |
324 |
Q |
| |
|
||||||||||||||||||||| |||||||| ||||||||||||||||||| |
|
|
| T |
12607683 |
ccaaatagctacttgagttctctacgttcgacttgatcaattatggttgc |
12607732 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 64; E-Value: 7e-28
Query Start/End: Original strand, 329 - 400
Target Start/End: Original strand, 12607985 - 12608056
Alignment:
| Q |
329 |
tagagtatggttttattaggctgttcagctttattgggtattttagtctacagagaagttttcactgcaaac |
400 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||| |
|
|
| T |
12607985 |
tagagtatggttttattaggctgttcagctttattgagtattttactctacagagaagttttcactgcaaac |
12608056 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 108 - 149
Target Start/End: Original strand, 12607432 - 12607473
Alignment:
| Q |
108 |
ttcagtttcactcatagaaacagtgaagagatgcaaatgtgt |
149 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12607432 |
ttcagtttcactcatagaaacagtgaagagatgcaaatgtgt |
12607473 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University