View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18467_high_27 (Length: 390)
Name: NF18467_high_27
Description: NF18467
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18467_high_27 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 240; Significance: 1e-133; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 3 - 374
Target Start/End: Complemental strand, 3490461 - 3490090
Alignment:
| Q |
3 |
ttcttgaaatttggtatcgataaagctccaaccctcttggaaattggttttggtgtagtctccatcttagaacttgatgaaatttctggcttccttgttt |
102 |
Q |
| |
|
||||||||||||| ||| ||| |||||||||||||||||||||||||||| |||||||| |||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
3490461 |
ttcttgaaatttgatattgatgaagctccaaccctcttggaaattggtttcggtgtagtgtccaccttagaacttgatgaaatttctggcttccttgttt |
3490362 |
T |
 |
| Q |
103 |
tgtaggtagagaaattctgcgatcttggaagtaggggtaatcgcttcacaccgaccaacgatgttttcttcctgtttaccacaccttcgttgccaggttt |
202 |
Q |
| |
|
| ||||||||| |||||||||| |||||||| ||||| ||||||||||||||| ||| |||||||||||||||||||||||| |||| ||||||||||| |
|
|
| T |
3490361 |
tataggtagagcaattctgcgaccttggaaggaggggcaatcgcttcacaccggccagtgatgttttcttcctgtttaccacaacttccttgccaggttt |
3490262 |
T |
 |
| Q |
203 |
aactagctcacctggtcctgttttaatgaccttgatagtgtctgagacattagaaatccgaacctcagaatcagttgattttccgtgtttgaccaatgac |
302 |
Q |
| |
|
||||||||| | ||| | ||||||| ||||||| | ||||||||||||||||||||||| |||||||||||||||||||| | |||||||||||| ||| |
|
|
| T |
3490261 |
aactagctcgcaaggttcagttttaacgaccttggtcgtgtctgagacattagaaatccggacctcagaatcagttgatttcctgtgtttgaccaacgac |
3490162 |
T |
 |
| Q |
303 |
atctttgttggttcggaattcattgatgcacgaagtttgacacccgacgttacgacttcagcaaggttctgt |
374 |
Q |
| |
|
||||| ||||||| |||||||||||||||||||||||||||||| || ||||||| |||||||||||||||| |
|
|
| T |
3490161 |
atcttggttggtttggaattcattgatgcacgaagtttgacacctgatgttacgatttcagcaaggttctgt |
3490090 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University