View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18467_high_39 (Length: 268)
Name: NF18467_high_39
Description: NF18467
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18467_high_39 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 181; Significance: 7e-98; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 181; E-Value: 7e-98
Query Start/End: Original strand, 68 - 252
Target Start/End: Complemental strand, 21435134 - 21434950
Alignment:
| Q |
68 |
ctctacaaggctcaatcacactcccactgacatgagtaacccaaacataataaaagaaaaaactaatttcctcttgatgttggaaaaaattgatccccag |
167 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21435134 |
ctctacaaggctcaatcacactcccactgacatgagtaacccaaacataataaaagaaaaaactaatttcctcttgatgttggaaaaaattgatccccag |
21435035 |
T |
 |
| Q |
168 |
tagtttcgaggagacatcgtggtcttgagtgcctttgataaaatttcttgatccatctcgaatattatagatttgaagcaaaagg |
252 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
21435034 |
tagtttcgaggagacatcgtggtcttgagtgcctttgataaaatttctcgatccatctcgaatattatagatttgaagcaaaagg |
21434950 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University