View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18467_high_43 (Length: 249)
Name: NF18467_high_43
Description: NF18467
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18467_high_43 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 161; Significance: 6e-86; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 161; E-Value: 6e-86
Query Start/End: Original strand, 22 - 238
Target Start/End: Complemental strand, 33615728 - 33615508
Alignment:
| Q |
22 |
cacatggagttaagttagttttccgaatatgtgattgtaagaatgtattggtaatgcaataagtttatactcacatgaacacc---------gttcagtt |
112 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||| |
|
|
| T |
33615728 |
cacatggagttaagtt-gttttccgaatatgtgattgtaagaatgtattggtaatgcaataagtttatactcacatgaacacctctaactatgtttagtt |
33615630 |
T |
 |
| Q |
113 |
attcaaaccaactcactcaacccgtattttacccaaatcagtttaagttcaatccaaactaacccgttcaaatttaacgtggtttggttatgataacaaa |
212 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
33615629 |
attcaaaccaactca----acccgtattttacccaaatcagtttaagttcaatccaaactaacccgttcaaatttaacgtggtttagttatgataacaaa |
33615534 |
T |
 |
| Q |
213 |
tttataatttcaaacatgtgaaccta |
238 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
33615533 |
tttataatttcaaacatgtgaaccta |
33615508 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University