View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18467_high_49 (Length: 226)

Name: NF18467_high_49
Description: NF18467
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18467_high_49
NF18467_high_49
[»] chr1 (2 HSPs)
chr1 (79-222)||(39475163-39475315)
chr1 (117-146)||(39474901-39474930)


Alignment Details
Target: chr1 (Bit Score: 109; Significance: 5e-55; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 109; E-Value: 5e-55
Query Start/End: Original strand, 79 - 222
Target Start/End: Original strand, 39475163 - 39475315
Alignment:
79 tagtcaacgatgattgcaaagattagttaaactctaacga---------gtttataaagattgacacccctcacatttctttagttaccacttccttatg 169  Q
    |||||||||||||||||||||||||||||||||||||| |         |||||||||||||||||||||||||||||||||||||||||||||||||||    
39475163 tagtcaacgatgattgcaaagattagttaaactctaacaacgacacaaagtttataaagattgacacccctcacatttctttagttaccacttccttatg 39475262  T
170 ttttccatgttaaattctcttaaacatcctccatgtcgttgttttccattttt 222  Q
    |||||||||||||||||||||||||||||| |||||||||| |||||||||||    
39475263 ttttccatgttaaattctcttaaacatccttcatgtcgttggtttccattttt 39475315  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 117 - 146
Target Start/End: Complemental strand, 39474930 - 39474901
Alignment:
117 gagtttataaagattgacacccctcacatt 146  Q
    ||||||||||||||||||||||||||||||    
39474930 gagtttataaagattgacacccctcacatt 39474901  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University