View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18467_high_49 (Length: 226)
Name: NF18467_high_49
Description: NF18467
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18467_high_49 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 109; Significance: 5e-55; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 109; E-Value: 5e-55
Query Start/End: Original strand, 79 - 222
Target Start/End: Original strand, 39475163 - 39475315
Alignment:
| Q |
79 |
tagtcaacgatgattgcaaagattagttaaactctaacga---------gtttataaagattgacacccctcacatttctttagttaccacttccttatg |
169 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39475163 |
tagtcaacgatgattgcaaagattagttaaactctaacaacgacacaaagtttataaagattgacacccctcacatttctttagttaccacttccttatg |
39475262 |
T |
 |
| Q |
170 |
ttttccatgttaaattctcttaaacatcctccatgtcgttgttttccattttt |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||| ||||||||||| |
|
|
| T |
39475263 |
ttttccatgttaaattctcttaaacatccttcatgtcgttggtttccattttt |
39475315 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 117 - 146
Target Start/End: Complemental strand, 39474930 - 39474901
Alignment:
| Q |
117 |
gagtttataaagattgacacccctcacatt |
146 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
39474930 |
gagtttataaagattgacacccctcacatt |
39474901 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University