View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18467_high_50 (Length: 224)
Name: NF18467_high_50
Description: NF18467
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18467_high_50 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 20 - 213
Target Start/End: Original strand, 41625289 - 41625482
Alignment:
| Q |
20 |
aaagggggcaacaacattccacatcgagatcaagggaaaagaaatatagttaaaaacataaaagaaaccgtacattagctgagaagacacaacttcttgt |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
41625289 |
aaagggggcaacaacattccacatcgagatcaagggaaaagaaatatagttaaaaacataaaagaaatcgtacattagctgagaagacacaacttcttgt |
41625388 |
T |
 |
| Q |
120 |
ttgtatcaattaaattaggttgagtaaatggtgggaggttttttatttcttctaactatcatcagcctcattgcacatgccaagtctgtggtgc |
213 |
Q |
| |
|
|||| | ||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
41625389 |
ttgttttaattaaattaggttgagtaaatggtggcaggttttttatttcttctaactatcatcggcctcattgcacatgccaagtctatggtgc |
41625482 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University