View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18467_high_52 (Length: 201)
Name: NF18467_high_52
Description: NF18467
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18467_high_52 |
 | |
|
| [»] scaffold0140 (1 HSPs) |
| | |
|
Alignment Details
Target: chr1 (Bit Score: 146; Significance: 4e-77; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 146; E-Value: 4e-77
Query Start/End: Original strand, 33 - 186
Target Start/End: Original strand, 35052454 - 35052607
Alignment:
| Q |
33 |
agatgccataattttgtacagctgccctccacacgtaagttcgtgttatcgactaaattttccatgacgtgtcgatatgcggagctaacattgtattcac |
132 |
Q |
| |
|
|||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35052454 |
agatcccataatttcgtacagctgccctccacacgtaagttcgtgttatcgactaaattttccatgacgtgtcgatatgcggagctaacattgtattcac |
35052553 |
T |
|
| Q |
133 |
catggggtgtaaaattccgtagatgtttgtccacttccacccccattgatgatg |
186 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35052554 |
catggggtgtaaaattccgtagatgtttgtccacttccacccccattgatgatg |
35052607 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0140 (Bit Score: 40; Significance: 0.00000000000007; HSPs: 1)
Name: scaffold0140
Description:
Target: scaffold0140; HSP #1
Raw Score: 40; E-Value: 0.00000000000007
Query Start/End: Original strand, 33 - 170
Target Start/End: Complemental strand, 30519 - 30378
Alignment:
| Q |
33 |
agatgccataattttgtacagctgccctccacacgtaagttcgtgttatcgactaaattttccatga--cgt--gtcgatatgcggagctaacattgtat |
128 |
Q |
| |
|
|||||||||| |||||| ||| || |||||||||||| | |||||||| |||||| ||||||||| ||| ||||||| |||||||||| | ||| |
|
|
| T |
30519 |
agatgccatagttttgtccagttgtcctccacacgtacatctgtgttatcaactaaactttccatgatgcgtacgtcgataaatggagctaacactatat |
30420 |
T |
|
| Q |
129 |
tcaccatggggtgtaaaattccgtagatgtttgtccacttcc |
170 |
Q |
| |
|
|||||||||||| ||||||||| || |||||| ||| ||||| |
|
|
| T |
30419 |
tcaccatggggtttaaaattccatacatgtttttcctcttcc |
30378 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 37; Significance: 0.000000000004; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 37; E-Value: 0.000000000004
Query Start/End: Original strand, 33 - 121
Target Start/End: Complemental strand, 43381093 - 43381005
Alignment:
| Q |
33 |
agatgccataattttgtacagctgccctccacacgtaagttcgtgttatcgactaaattttccatgacgtgtcgatatgcggagctaac |
121 |
Q |
| |
|
|||||||||||||| || || ||||||| |||||||||| || ||||||||||||||||| ||||| |||| || | ||| ||||||| |
|
|
| T |
43381093 |
agatgccataatttcgtccaattgccctctacacgtaagtccgcgttatcgactaaatttttcatgatgtgttgacacgcgaagctaac |
43381005 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University