View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18467_low_33 (Length: 307)
Name: NF18467_low_33
Description: NF18467
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18467_low_33 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 269; Significance: 1e-150; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 269; E-Value: 1e-150
Query Start/End: Original strand, 1 - 289
Target Start/End: Complemental strand, 40676364 - 40676076
Alignment:
| Q |
1 |
ttatactgttattacagtgatatactaatttacagttaaatgttcttgctgctcaataactaaaaaactgaatcagcagattagtcaccgaaactgtaag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
40676364 |
ttatactgttattacagtgatatactaatttacagttaaatgttcttgctgctcaatacctaaaaaaatgaatcagcagattagtcaccgaaactgtaag |
40676265 |
T |
 |
| Q |
101 |
tatgattgaaataatttctcaatttttctaattggcatatacattttagaaattgtaaaatgtcacgcaaaatgtccctcacttagcttctgttattaag |
200 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
40676264 |
tatgattgaaataatttctcaatttttcgaattggcatatacattttagaaattgtaaaatgtcacgcaaaatgtccctcacttagcttttgttattaag |
40676165 |
T |
 |
| Q |
201 |
agggtgtgacgtgtcatgttgcacatcgatctcacataatgttatcagttcactatcaactaatttgactataaaatttaggttatatc |
289 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40676164 |
agggtgtgacgtgtcatattgcacatcgatctcacataatgttatcagttcactatcaactaatttgactataaaatttaggttatatc |
40676076 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 249 - 289
Target Start/End: Complemental strand, 10096880 - 10096840
Alignment:
| Q |
249 |
ttcactatcaactaatttgactataaaatttaggttatatc |
289 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| ||||| |
|
|
| T |
10096880 |
ttcactatcaactaatttgcctataaaatttaggtcatatc |
10096840 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University