View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18467_low_35 (Length: 305)
Name: NF18467_low_35
Description: NF18467
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18467_low_35 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 8 - 283
Target Start/End: Original strand, 39475395 - 39475664
Alignment:
| Q |
8 |
tcaatgcacttatcatatattttgtatccctcctattgcatgttatctttttcaacattgtaaaaaattgattttgaacagnnnnnnnnnnnnn-atttg |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||| |
|
|
| T |
39475395 |
tcaatgcacttatcatatattttgtatccctcctattgcatgttatctttttcaacatagtaaaaaattgattttgaacagttttttttatttttattta |
39475494 |
T |
 |
| Q |
107 |
aatcatttttgtttggatgtgaactgctccaacaagtaaaattggcataaatcgttaatgattcatctcaaaccaaaccgaaatgttttaaaagttcagt |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39475495 |
aatcatttttgtttggatgtgaactgctccaacaagtaaaattggcataaatcgttaatgattcatctcaaaccaaaccgaaatgttttaaaagttcagt |
39475594 |
T |
 |
| Q |
207 |
gcatcaattctaatttctaaagcttcaaatctaacagaaactatcttcacaaaaaaggactgccctacaagtagata |
283 |
Q |
| |
|
||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39475595 |
gcatcaa-------ttctaaggcttcaaatctaacagaaactatcttcacaaaaaaggactgccctacaagtagata |
39475664 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University