View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18467_low_39 (Length: 268)

Name: NF18467_low_39
Description: NF18467
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18467_low_39
NF18467_low_39
[»] chr3 (1 HSPs)
chr3 (68-252)||(21434950-21435134)


Alignment Details
Target: chr3 (Bit Score: 181; Significance: 7e-98; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 181; E-Value: 7e-98
Query Start/End: Original strand, 68 - 252
Target Start/End: Complemental strand, 21435134 - 21434950
Alignment:
68 ctctacaaggctcaatcacactcccactgacatgagtaacccaaacataataaaagaaaaaactaatttcctcttgatgttggaaaaaattgatccccag 167  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
21435134 ctctacaaggctcaatcacactcccactgacatgagtaacccaaacataataaaagaaaaaactaatttcctcttgatgttggaaaaaattgatccccag 21435035  T
168 tagtttcgaggagacatcgtggtcttgagtgcctttgataaaatttcttgatccatctcgaatattatagatttgaagcaaaagg 252  Q
    |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||    
21435034 tagtttcgaggagacatcgtggtcttgagtgcctttgataaaatttctcgatccatctcgaatattatagatttgaagcaaaagg 21434950  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University