View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18467_low_51 (Length: 216)
Name: NF18467_low_51
Description: NF18467
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18467_low_51 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 153; Significance: 3e-81; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 19 - 200
Target Start/End: Original strand, 14123469 - 14123660
Alignment:
| Q |
19 |
ataggtaacacatgcatatgatgaatacccttctattca----------ctcttttgcactaaccttaatggttccaatctttattgatccatgcccaaa |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14123469 |
ataggtaacacatgcatatgatgaatacccttctattcattccttttcactcttttgcactaaccttaatggttccaatctttattgatccatgcccaaa |
14123568 |
T |
 |
| Q |
109 |
aatggaaatttcatatatgacttttttcttaatttgtttctacaggtaacatcatctcaattctcatgtttctttctcctgtgtaagttctt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
14123569 |
aatggaaatttcatatatgacttttttcttaatttgtttctacaggtaacatcatctcaattctcatgtttctttctcctgtgtaagctctt |
14123660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University