View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18468_low_4 (Length: 328)
Name: NF18468_low_4
Description: NF18468
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18468_low_4 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 112; Significance: 1e-56; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 112; E-Value: 1e-56
Query Start/End: Original strand, 1 - 148
Target Start/End: Complemental strand, 14193018 - 14192871
Alignment:
| Q |
1 |
tctaatccggctgtctgtcacagtagaaaagtgcataaaatcaagtatatgagcacagcccctggtattttgtaaagggtaaccgaatgccctctgcaca |
100 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||| || | ||||||||||||||||||||||||| |
|
|
| T |
14193018 |
tctaatccggctgtcttccacagtagaaaagtgcattaaatcaagtatatgagcacagcccctggtattctgaagagggtaaccgaatgccctctgcaca |
14192919 |
T |
|
| Q |
101 |
attctagcaacccgatgatcgttccagacctccacatattgagcaacc |
148 |
Q |
| |
|
|||||||||||||||||||||||||| |||| ||||| |||||||||| |
|
|
| T |
14192918 |
attctagcaacccgatgatcgttccaaacctgcacatgttgagcaacc |
14192871 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 234 - 313
Target Start/End: Complemental strand, 14192743 - 14192664
Alignment:
| Q |
234 |
caaccgggtgatcgacctcgggtacaaaattttcgcccaaggttttcctgtataacttcttgagaacaatgaagggtatt |
313 |
Q |
| |
|
||||||||| |||| |||||||||||| ||||||| | |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14192743 |
caaccgggttatcgtgctcgggtacaaatctttcgccgatggttttcctgtataacttcttgagaacaatgaagggtatt |
14192664 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University