View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18469_high_10 (Length: 307)
Name: NF18469_high_10
Description: NF18469
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18469_high_10 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 285; Significance: 1e-160; HSPs: 4)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 285; E-Value: 1e-160
Query Start/End: Original strand, 1 - 289
Target Start/End: Complemental strand, 43222627 - 43222339
Alignment:
| Q |
1 |
gtgggaatgaggaaaatcaagtctcagtgttcgatctctggaatgaacgggcctgtgggaattaggaaaatcaggtctcagtgtttgctctccgagatgg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43222627 |
gtgggaatgaggaaaatcaagtctcagtgttcgatctctggaatgaacgggcctgtgggaattaggaaaatcaggtctcagtgtttgctctccgagatgg |
43222528 |
T |
|
| Q |
101 |
atgcttttgatctctctggcttgcttgacaatccaaggctaaacatagagagacagagatcagttgatgacagtttactcagtgaactgtccattggagc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43222527 |
atgcttttgatctctctggcttgcttgacaatccaaggctaaacatagagagacagagatcagttgatgacagtttactcagtgaactgtccattggagc |
43222428 |
T |
|
| Q |
201 |
aagatcactttcatctgctcagaactcgttcgagcctcagccaatgcttgctgatgcctgggaatctctcaggaagtctctagtctatt |
289 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43222427 |
aagatcattttcatctgctcagaactcgttcgagcctcagccaatgcttgctgatgcctgggaatctctcaggaagtctctagtctatt |
43222339 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 210 - 285
Target Start/End: Complemental strand, 43232831 - 43232756
Alignment:
| Q |
210 |
ttcatctgctcagaactcgttcgagcctcagccaatgcttgctgatgcctgggaatctctcaggaagtctctagtc |
285 |
Q |
| |
|
||||||||||| |||||||| ||||| || |||||| |||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
43232831 |
ttcatctgctcgcaactcgtttgagccgcatccaatggttgctgatgcctgggaatctctcaggaaatctctagtc |
43232756 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 56 - 170
Target Start/End: Complemental strand, 43233045 - 43232931
Alignment:
| Q |
56 |
tgggaattaggaaaatcaggtctcagtgtttgctctccgagatggatgcttttgatctctctggcttgcttgacaatccaaggctaaacatagagagaca |
155 |
Q |
| |
|
|||||||||||||| || | |||||||||| | | | |||||||||| ||| |||||| || | |||||||||| || |||||||||||||||||||| |
|
|
| T |
43233045 |
tgggaattaggaaagtcggctctcagtgttcgatggctgagatggatgatttcgatctcactcgtttgcttgacaggccgaggctaaacatagagagaca |
43232946 |
T |
|
| Q |
156 |
gagatcagttgatga |
170 |
Q |
| |
|
||||||| ||||||| |
|
|
| T |
43232945 |
gagatcatttgatga |
43232931 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 42 - 85
Target Start/End: Complemental strand, 43222640 - 43222597
Alignment:
| Q |
42 |
aatgaacgggcctgtgggaattaggaaaatcaggtctcagtgtt |
85 |
Q |
| |
|
||||||||||| ||||||||| |||||||||| ||||||||||| |
|
|
| T |
43222640 |
aatgaacgggcttgtgggaatgaggaaaatcaagtctcagtgtt |
43222597 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University