View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18469_high_10 (Length: 307)

Name: NF18469_high_10
Description: NF18469
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18469_high_10
NF18469_high_10
[»] chr1 (4 HSPs)
chr1 (1-289)||(43222339-43222627)
chr1 (210-285)||(43232756-43232831)
chr1 (56-170)||(43232931-43233045)
chr1 (42-85)||(43222597-43222640)


Alignment Details
Target: chr1 (Bit Score: 285; Significance: 1e-160; HSPs: 4)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 285; E-Value: 1e-160
Query Start/End: Original strand, 1 - 289
Target Start/End: Complemental strand, 43222627 - 43222339
Alignment:
1 gtgggaatgaggaaaatcaagtctcagtgttcgatctctggaatgaacgggcctgtgggaattaggaaaatcaggtctcagtgtttgctctccgagatgg 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43222627 gtgggaatgaggaaaatcaagtctcagtgttcgatctctggaatgaacgggcctgtgggaattaggaaaatcaggtctcagtgtttgctctccgagatgg 43222528  T
101 atgcttttgatctctctggcttgcttgacaatccaaggctaaacatagagagacagagatcagttgatgacagtttactcagtgaactgtccattggagc 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43222527 atgcttttgatctctctggcttgcttgacaatccaaggctaaacatagagagacagagatcagttgatgacagtttactcagtgaactgtccattggagc 43222428  T
201 aagatcactttcatctgctcagaactcgttcgagcctcagccaatgcttgctgatgcctgggaatctctcaggaagtctctagtctatt 289  Q
    ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43222427 aagatcattttcatctgctcagaactcgttcgagcctcagccaatgcttgctgatgcctgggaatctctcaggaagtctctagtctatt 43222339  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 210 - 285
Target Start/End: Complemental strand, 43232831 - 43232756
Alignment:
210 ttcatctgctcagaactcgttcgagcctcagccaatgcttgctgatgcctgggaatctctcaggaagtctctagtc 285  Q
    |||||||||||  |||||||| ||||| || |||||| |||||||||||||||||||||||||||| |||||||||    
43232831 ttcatctgctcgcaactcgtttgagccgcatccaatggttgctgatgcctgggaatctctcaggaaatctctagtc 43232756  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 56 - 170
Target Start/End: Complemental strand, 43233045 - 43232931
Alignment:
56 tgggaattaggaaaatcaggtctcagtgtttgctctccgagatggatgcttttgatctctctggcttgcttgacaatccaaggctaaacatagagagaca 155  Q
    |||||||||||||| || | |||||||||| | |  | |||||||||| ||| |||||| || | ||||||||||  || ||||||||||||||||||||    
43233045 tgggaattaggaaagtcggctctcagtgttcgatggctgagatggatgatttcgatctcactcgtttgcttgacaggccgaggctaaacatagagagaca 43232946  T
156 gagatcagttgatga 170  Q
    ||||||| |||||||    
43232945 gagatcatttgatga 43232931  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 42 - 85
Target Start/End: Complemental strand, 43222640 - 43222597
Alignment:
42 aatgaacgggcctgtgggaattaggaaaatcaggtctcagtgtt 85  Q
    ||||||||||| ||||||||| |||||||||| |||||||||||    
43222640 aatgaacgggcttgtgggaatgaggaaaatcaagtctcagtgtt 43222597  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University