View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1846_low_11 (Length: 235)
Name: NF1846_low_11
Description: NF1846
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1846_low_11 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 221; Significance: 1e-122; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 25541865 - 25541645
Alignment:
| Q |
1 |
ttgtttctatcttccttaattgttacttactaggaattaagtcttgatttttgcatcactttttaatcgtacaagtggatttttctttgaaaatttcaat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25541865 |
ttgtttctatcttccttaattgttacttactaggaattaagtcttgatttttgcatcactttttaatcgtacaagtggatttttctttgaaaatttcaat |
25541766 |
T |
 |
| Q |
101 |
tatattggcataatatgattgtatgttatggaaaatgtgccactagagtgctatatctaagctgaaatcacctctctctttttacattgaattgcttgca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25541765 |
tatattggcataatatgattgtatgttatggaaaatgtgccactagagtgctatatctaagctgaaatcacctctctctttttacattgaattgcttgca |
25541666 |
T |
 |
| Q |
201 |
gctgcaaattcatgttgtttc |
221 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
25541665 |
gctgcaaattcatgttgtttc |
25541645 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 96; Significance: 3e-47; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 96; E-Value: 3e-47
Query Start/End: Original strand, 43 - 221
Target Start/End: Complemental strand, 11980122 - 11979945
Alignment:
| Q |
43 |
cttgatttttgcatcactttttaatcgtacaagtggatttttctttgaaaatttcaattatattgg--cataatatgattgtatgttatggaaaatgtgc |
140 |
Q |
| |
|
|||||||| |||| | |||||||||| || ||||||||||||||||| |||||| | ||||||||| ||| ||| |||||||| || | |||||||| |
|
|
| T |
11980122 |
cttgatttctgcaacgctttttaatcatataagtggatttttctttggaaatttgagttatattggtgcatgataggattgtatattgt---aaatgtgc |
11980026 |
T |
 |
| Q |
141 |
cactagagtgctatatctaagctgaaatcacctctctctttttacattgaattgcttgcagctgcaaattcatgttgtttc |
221 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||| |||||| |
|
|
| T |
11980025 |
cactagagtgctatatctaagctgaaatcacctctctctttttacattgaattccttgcagttgcaaattcatggtgtttc |
11979945 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 109 - 173
Target Start/End: Complemental strand, 11978794 - 11978730
Alignment:
| Q |
109 |
cataatatgattgtatgttatggaaaatgtgccactagagtgctatatctaagctgaaatcacct |
173 |
Q |
| |
|
||||| |||||||| | |||||||||| |||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
11978794 |
cataacatgattgtctattatggaaaaagtgcaactagagtgctatacctaagctgaaatcacct |
11978730 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University