View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1846_low_13 (Length: 224)
Name: NF1846_low_13
Description: NF1846
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1846_low_13 |
 |  |
|
| [»] scaffold0194 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0194 (Bit Score: 130; Significance: 2e-67; HSPs: 1)
Name: scaffold0194
Description:
Target: scaffold0194; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 1 - 142
Target Start/End: Original strand, 19735 - 19876
Alignment:
| Q |
1 |
attgtgtagaccacaaagaggaaaggatgggttaatcatgggataaaaggagctgaatccatagctgaccatatgtaccgtatggctttgatgtcactta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
19735 |
attgtgtagaccacaaagaggaaaggatgggttaatcatgggataaaaggagctgaatccatagctgaccatatgtaccgtatggctttgatgtcactca |
19834 |
T |
 |
| Q |
101 |
ttgtttctgatgttcctggattgagtagagaaaggttcactg |
142 |
Q |
| |
|
||| |||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
19835 |
ttgcttctcatgttcctggattgagtagagaaaggttcactg |
19876 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University