View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1846_low_6 (Length: 286)
Name: NF1846_low_6
Description: NF1846
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1846_low_6 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 116; Significance: 5e-59; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 116; E-Value: 5e-59
Query Start/End: Original strand, 9 - 201
Target Start/End: Original strand, 5233415 - 5233607
Alignment:
| Q |
9 |
aaaatactttatgttgcagccgcaattgtggttgcagcagtagcaatcacacggctgcggaatgcaatttgaaacaatggttcttcccatagctacaaga |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||| |||||| |||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
5233415 |
aaaatactttatgttgcagccgcaattgtggttgcag---tagcaattacacggtggcggaatgcaatttaaaacaatggttcttcccatagctacaaga |
5233511 |
T |
 |
| Q |
109 |
agattagatttgttgcatgcttctatatcttgctgcataattatgtacaagaaatatc---tatggttttaaattgcaattgcggtcacagttgca |
201 |
Q |
| |
|
|||||| |||||||||||||| | ||||||||| |||| ||||||||||||||||| ||||||||||||||||| |||| |||||||||||| |
|
|
| T |
5233512 |
agattaagtttgttgcatgcttatttatcttgctaaataactatgtacaagaaatatctattatggttttaaattgcacttgccgtcacagttgca |
5233607 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University