View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18470_low_6 (Length: 306)
Name: NF18470_low_6
Description: NF18470
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18470_low_6 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 257; Significance: 1e-143; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 257; E-Value: 1e-143
Query Start/End: Original strand, 17 - 306
Target Start/End: Original strand, 387408 - 387697
Alignment:
| Q |
17 |
actccgcttgttcaacattgatatgatacgggaacatgggacaaaggatgtgttttatgtcattgatatcaattactttccaggcaagtacaacttatgt |
116 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
387408 |
actccacttgttcaacattgatatgatacgggaacatgggacaaaggatgtgttttatgtcattgatatcaattactttccaggcaagtacaacttatgt |
387507 |
T |
|
| Q |
117 |
caatttatgtcattgattattttgtgtatcaaagtttaagnnnnnnngtagcaagtcaatgattcctttttccatttccgggcattgcatgtgttgaatt |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
387508 |
caatttatgtcattgattattttgtgtatcaaagtttaagcttttttgtagcaagtcaatgattcctttttccatttccgagcattgcatgtgttgaatt |
387607 |
T |
|
| Q |
217 |
tgccgctgtgccaaagtggttgaacagctttctctttaatcctctgcagggtatggaaaaatgccagagtatgaacacatatttatagat |
306 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
387608 |
tgccgctgtgccaaagtggttgaacagctttctctttaatcctctgcagggtatggaaaaatgccagagtatgaacaaatatttatagat |
387697 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 58; Significance: 2e-24; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 21 - 114
Target Start/End: Complemental strand, 47847104 - 47847011
Alignment:
| Q |
21 |
cgcttgttcaacattgatatgatacgggaacatgggacaaaggatgtgttttatgtcattgatatcaattactttccaggcaagtacaacttat |
114 |
Q |
| |
|
|||||||||||| | |||||||| || ||| ||||||| |||||||||||||||||||||||||||||||||||||| || ||||| ||||||| |
|
|
| T |
47847104 |
cgcttgttcaacgtagatatgattcgtgaatatgggacgaaggatgtgttttatgtcattgatatcaattactttcctggtaagtataacttat |
47847011 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University