View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18470_low_7 (Length: 276)
Name: NF18470_low_7
Description: NF18470
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18470_low_7 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 216; Significance: 1e-118; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 216; E-Value: 1e-118
Query Start/End: Original strand, 19 - 260
Target Start/End: Complemental strand, 28414027 - 28413789
Alignment:
| Q |
19 |
gccactttttcaacacactctttaacatttactctcttatccccaacttttcccatcctcgtcctcactctatgctattgtgagttttttccccctttcc |
118 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
28414027 |
gccactttttcaacacactctttaacattcactctcttatccccaacttttcccatgctcgtcctcgctctatgctattgtgagttttttccccctttcc |
28413928 |
T |
|
| Q |
119 |
caacccttcccatacatgtggctctacacaacccaacaaaataaaagatttatgtttatgtaaaactactaaattgcaaaatatgacttacattatgagg |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
28413927 |
caacccttcccatacatgtggctctacacaacccaacaaaataaaagatttatgtttatgtaaa---actaaattgcaaaatatgacttacattatgagg |
28413831 |
T |
|
| Q |
219 |
aaactaggcttgtgtttggaaccgcggtgaagacgaggctag |
260 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28413830 |
aaactaggcttgtgtttggaaccgcggtgaagacgaggctag |
28413789 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University