View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18471_high_19 (Length: 331)
Name: NF18471_high_19
Description: NF18471
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18471_high_19 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 25 - 315
Target Start/End: Original strand, 32551893 - 32552179
Alignment:
| Q |
25 |
gtagagtccaaatgattttatttggtttcattgcaaaatatgaaaagcaaaatacaaataaggtgataatagattaataattcacggggctagattcaga |
124 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
32551893 |
gtagagtccaaatgattttatttggtttcatcgcaaaatatgaaaaacaaaatacaaataaggtgataatagattaataattaacggggctagattcaga |
32551992 |
T |
 |
| Q |
125 |
tattgacattc-----atgttatatagtgagcaattatattcacttgttaaccattctcaaaagttgaagctttgagaatggcatttacaagattaagtt |
219 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
32551993 |
tattgacattcaattcatgttatatagtgagcaattatattcacttgttaactattctcaaaagttgaagctttgagaatggcatttacaagattaactt |
32552092 |
T |
 |
| Q |
220 |
ggctatcaaattcaaacaatacatgctcaaaaccatgaccatgaacacggatgtgttaaccacactcgttactcgtataagaagtacaaaaggacg |
315 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||| |
|
|
| T |
32552093 |
ggctatcaaattcaaacaatacatgctcaaaaccatgaccatgaacacggatgtgt-------actc--tactcgtataagaagtacaaaaggacg |
32552179 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University