View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18471_low_29 (Length: 213)
Name: NF18471_low_29
Description: NF18471
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18471_low_29 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 143; Significance: 3e-75; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 19 - 202
Target Start/End: Original strand, 340369 - 340551
Alignment:
| Q |
19 |
tggattgtggaaaataatgataattatatgattatgacgatgattggannnnnnngtgtgaatgcgattcttcttcttgaagatccagactccaatatca |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
340369 |
tggattgtggaaaataatgataattatatgattatgacgatgattggattttttt-tgtgaatgcgattcttcttcttgaagatccagactccaatatca |
340467 |
T |
|
| Q |
119 |
cgttcgtgtttgcttcctcgatgagcctcagaatcacgatcaaaatcacgtggatctttattcaactacactctttcttctctc |
202 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
340468 |
cgttcgtgtttgcttcctccatgagcctcagaatcacgatcagaatcacgtggatctttattcaactacactctttcttttctc |
340551 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 121; Significance: 4e-62; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 121; E-Value: 4e-62
Query Start/End: Original strand, 19 - 202
Target Start/End: Original strand, 42318572 - 42318763
Alignment:
| Q |
19 |
tggattgtggaaaataatgataattatat--gattatgacgatgattggannnnnnngtgtgaatgcgattcttcttcttgaagatccagactccaatat |
116 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42318572 |
tggattgtggaaaataatgataattatatatgattatgacaatgattggatttttttgtgtgaatgcgattcttcttcttgaagatccagactccaatat |
42318671 |
T |
|
| Q |
117 |
cac------gttcgtgtttgcttcctcgatgagcctcagaatcacgatcaaaatcacgtggatctttattcaactacactctttcttctctc |
202 |
Q |
| |
|
||| ||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
42318672 |
cacattcacgttcgcgtttgcttcctcgatgagcctcagaatcacaatcaaaatcacgtggatctttattcaactacactctttcttttctc |
42318763 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University