View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18472_high_11 (Length: 215)
Name: NF18472_high_11
Description: NF18472
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18472_high_11 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 62; Significance: 6e-27; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 62; E-Value: 6e-27
Query Start/End: Original strand, 61 - 146
Target Start/End: Original strand, 39823452 - 39823537
Alignment:
| Q |
61 |
ctggaaccttgtggtattaccactttgtacattcagttgcttcgggacaagtttcatcttcttctttagcctaaaaaatgacgtcc |
146 |
Q |
| |
|
||||||||||||||||||| |||| |||||||| ||||||||||||||||||||||||||||| ||||| |||||||| ||||||| |
|
|
| T |
39823452 |
ctggaaccttgtggtattatcactctgtacatttagttgcttcgggacaagtttcatcttcttgtttagtctaaaaaacgacgtcc |
39823537 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 62 - 146
Target Start/End: Original strand, 39917426 - 39917510
Alignment:
| Q |
62 |
tggaaccttgtggtattaccactttgtacattcagttgcttcgggacaagtttcatcttcttctttagcctaaaaaatgacgtcc |
146 |
Q |
| |
|
||||| |||||||||||| |||||||||| ||||||||||| |||||| ||||||||||||||||||||| |||||| |||||| |
|
|
| T |
39917426 |
tggaaacttgtggtattatcactttgtaccttcagttgctttgggacacgtttcatcttcttctttagccataaaaattacgtcc |
39917510 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 12 - 45
Target Start/End: Original strand, 39924527 - 39924560
Alignment:
| Q |
12 |
aataatatgtattcaattcacattattttgtaaa |
45 |
Q |
| |
|
||||||||||||||||||||||||||||| |||| |
|
|
| T |
39924527 |
aataatatgtattcaattcacattattttataaa |
39924560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University