View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18472_high_12 (Length: 212)
Name: NF18472_high_12
Description: NF18472
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18472_high_12 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 128; Significance: 2e-66; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 128; E-Value: 2e-66
Query Start/End: Original strand, 11 - 193
Target Start/End: Original strand, 2069984 - 2070162
Alignment:
| Q |
11 |
gagtgagatgaacacatccttcnnnnnnnntataacaagattaatgttagagaaaactttgacagttaacagagaatcaaattcaattattcccttgttt |
110 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2069984 |
gagtgagatgaacacatccttcaaaaaaaatataacaagatt-----tagagaaaactttgacagttaacagagaatcaaattcaattattcccttgttt |
2070078 |
T |
|
| Q |
111 |
gatgagtttgtatcgaagtatgcaaagtcgcttgtagaagaattgcagcgcagctttttcccc-tcctcacaggcgccgccacc |
193 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||| |
|
|
| T |
2070079 |
gatgagtttgtatcgaagtatgcaaagtcgcttgtagaagaattgcagcgcagctttttccccttcctcacaagcgccgccacc |
2070162 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 120; E-Value: 1e-61
Query Start/End: Original strand, 11 - 193
Target Start/End: Original strand, 2074330 - 2074508
Alignment:
| Q |
11 |
gagtgagatgaacacatccttcnnnnnnnntataacaagattaatgttagagaaaactttgacagttaacagagaatcaaattcaattattcccttgttt |
110 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
2074330 |
gagtgagatgaacacatccttcaaaaaaaatataacaagatt-----tagagaaaactttgacagttaacagagaatcaaattcaattattcccttattt |
2074424 |
T |
|
| Q |
111 |
gatgagtttgtatcgaagtatgcaaagtcgcttgtagaagaattgcagcgcagctttttcccc-tcctcacaggcgccgccacc |
193 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||| |
|
|
| T |
2074425 |
gatgagtttgtatcgaagtatgcaaagtcgcttgtagaagaattgcagcgcagctttttccccttcctcaccagcgccgccacc |
2074508 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University