View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18472_high_4 (Length: 306)
Name: NF18472_high_4
Description: NF18472
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18472_high_4 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 113; Significance: 3e-57; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 113; E-Value: 3e-57
Query Start/End: Original strand, 106 - 252
Target Start/End: Complemental strand, 24407269 - 24407119
Alignment:
| Q |
106 |
ttagatttcaatcagagagaagata-ggaagctaataat---taaggaacaaaactgaacagaacaaaacacacctagcagcagcgagatgtgaagagac |
201 |
Q |
| |
|
||||||||||||||||||||| ||| ||||||||||||| |||||||||||||||||||||| |||||||||||||||||||| |||||||||||||| |
|
|
| T |
24407269 |
ttagatttcaatcagagagaaaataaggaagctaataataattaaggaacaaaactgaacagaagaaaacacacctagcagcagcaagatgtgaagagac |
24407170 |
T |
|
| Q |
202 |
aacattgtgataattagtagcattgtgaaaagagtttactacaatgacaat |
252 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24407169 |
aacatcgtgataattagtagcattgtgaaaagagtttactacaatgacaat |
24407119 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University