View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18472_low_7 (Length: 250)
Name: NF18472_low_7
Description: NF18472
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18472_low_7 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 14 - 231
Target Start/End: Complemental strand, 24993352 - 24993139
Alignment:
| Q |
14 |
gcacagagagagccaaaaacctgtgaccgaattttcatcgatatcatcttgttcatatttgagccgctccaacacattatttaacaataataaatcagtt |
113 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
24993352 |
gcacagagagagccaaaaaccagtgaccgaattttcatcgatatcatctcgttcatattttagccgctccaacacattatttaacaatattaaatcagtt |
24993253 |
T |
 |
| Q |
114 |
tactgcacatgctagcattttgcagatgccatacttgttgtaaatttgcagctttagttttgtattcaaaagctatatagataaatatacacacacattc |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||| |
|
|
| T |
24993252 |
tactgcacatgctagcattttgcagatgccatacttgttgtaaatttgcagctttagttttgtattcaaaagctatatatctaaatata----cacattc |
24993157 |
T |
 |
| Q |
214 |
atctacacacaaaccttt |
231 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
24993156 |
atctacacacaaaccttt |
24993139 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University