View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18473_high_4 (Length: 208)
Name: NF18473_high_4
Description: NF18473
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18473_high_4 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 114; Significance: 5e-58; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 114; E-Value: 5e-58
Query Start/End: Original strand, 17 - 155
Target Start/End: Complemental strand, 2214379 - 2214241
Alignment:
| Q |
17 |
ttctgaaattacgtgggttgatttgggttttcactaattggattgggttcttaaaatatggattagatttgctaatgttgttgattttaaggatgtggtt |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
2214379 |
ttctgaaattacgtgggttgatttgggttttcactaattggattgggttcttaaaatatggattaggtttgctaatgttgttgattttaaggatgtggtt |
2214280 |
T |
 |
| Q |
117 |
gtgnnnnnnnattatgatgtggtggaaagaactaaaggg |
155 |
Q |
| |
|
||| ||||||||||||||||||||||||||||| |
|
|
| T |
2214279 |
gtgttttttgattatgatgtggtggaaagaactaaaggg |
2214241 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 106; Significance: 3e-53; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 106; E-Value: 3e-53
Query Start/End: Original strand, 21 - 190
Target Start/End: Complemental strand, 21843610 - 21843440
Alignment:
| Q |
21 |
gaaattacgtgggttgatttgggttttcactaattggattgggttcttaaaatatggattagatttgctaatgttgttgattttaaggatgtggttgtgn |
120 |
Q |
| |
|
||||||| |||||||||||||| ||||||||| |||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
21843610 |
gaaattatgtgggttgatttggtttttcactagttggattgggtttttaaaatatggattaggtttgctaatgttgttgattttaaggatgtggttgtgt |
21843511 |
T |
 |
| Q |
121 |
nnnnnnattatgatgtggtggaaagaa-ctaaagggaagaagaaaggggaggtgatggttgttgggaggtg |
190 |
Q |
| |
|
||||||||||||||||||||| | ||| ||||||||||| |||||||||||||||||||| |||| |
|
|
| T |
21843510 |
tttttgattatgatgtggtggaaagaacccaaatggaagaagaaaagggaggtgatggttgttgggtggtg |
21843440 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University