View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18473_low_1 (Length: 299)
Name: NF18473_low_1
Description: NF18473
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18473_low_1 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 116; Significance: 5e-59; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 116; E-Value: 5e-59
Query Start/End: Original strand, 17 - 132
Target Start/End: Original strand, 31879650 - 31879765
Alignment:
| Q |
17 |
aataatgatgatataactagtcatcaacaggtaaaatggcaccccgtccaaatacgcaggtcccatgcatgttgtaaaaatatctatttagagctgaaac |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31879650 |
aataatgatgatataactagtcatcaacaggtaaaatggcaccccgtccaaatacgcaggtcccatgcatgttgtaaaaatatctatttagagctgaaac |
31879749 |
T |
|
| Q |
117 |
agtagggggcaacttt |
132 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
31879750 |
agtagggggcaacttt |
31879765 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 191 - 289
Target Start/End: Original strand, 31879821 - 31879919
Alignment:
| Q |
191 |
gtaattgatgaatcaaaataatttactgatccaattaacaatttattaaaaattctttaagaaattcaattcatccattcaacgcataaatcacctatg |
289 |
Q |
| |
|
||||||||||||||||||||||||| |||||||| |||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
31879821 |
gtaattgatgaatcaaaataatttagtgatccaaataacaatttattgaaaattctttaagaaattcaattcatccattcaacccataaatcacctatg |
31879919 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University