View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18473_low_3 (Length: 220)
Name: NF18473_low_3
Description: NF18473
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18473_low_3 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 52 - 205
Target Start/End: Complemental strand, 35999190 - 35999037
Alignment:
| Q |
52 |
acaaataaatataattaatcctgaatcatatcttgggggttaagtgattagttaatagtgctgggtgggatgtcagagtatatgcatgcagtttatgtaa |
151 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35999190 |
acaaataaatataattaatcttgaatcatatcttgggggttaagtgattagttaatagtgctgggtgggatgtcagagtatatgcatgcagtttatgtaa |
35999091 |
T |
 |
| Q |
152 |
gacaagaagttatgccaaaacatttggttttggttattgttattaggtgttcat |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35999090 |
gacaagaagttatgccaaaacatttggttttggttattgttattaggtgttcat |
35999037 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University