View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18473_low_3 (Length: 220)

Name: NF18473_low_3
Description: NF18473
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18473_low_3
NF18473_low_3
[»] chr1 (1 HSPs)
chr1 (52-205)||(35999037-35999190)


Alignment Details
Target: chr1 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 52 - 205
Target Start/End: Complemental strand, 35999190 - 35999037
Alignment:
52 acaaataaatataattaatcctgaatcatatcttgggggttaagtgattagttaatagtgctgggtgggatgtcagagtatatgcatgcagtttatgtaa 151  Q
    |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
35999190 acaaataaatataattaatcttgaatcatatcttgggggttaagtgattagttaatagtgctgggtgggatgtcagagtatatgcatgcagtttatgtaa 35999091  T
152 gacaagaagttatgccaaaacatttggttttggttattgttattaggtgttcat 205  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||    
35999090 gacaagaagttatgccaaaacatttggttttggttattgttattaggtgttcat 35999037  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University