View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18474_low_4 (Length: 206)
Name: NF18474_low_4
Description: NF18474
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18474_low_4 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 159; Significance: 7e-85; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 159; E-Value: 7e-85
Query Start/End: Original strand, 22 - 192
Target Start/End: Original strand, 18320025 - 18320195
Alignment:
| Q |
22 |
aagtataggcaagaatggatgtgtggcattaaagctagatatgtcaaatatggagggaattttttgattgaggtgtttttaaagaaatataatatttgca |
121 |
Q |
| |
|
||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18320025 |
aagtacaggcaagaatggatgtgtggcattaaggctagatatgtcaaatatggagggaattttttgattgaggtgtttttaaagaaatataatatttgca |
18320124 |
T |
|
| Q |
122 |
ttcaccctcctaaattacccaagattattgaagtaatatgacaacctcctctcttttattgggtcaaatgt |
192 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
18320125 |
ttcaccctcctaaattacccaagattattgaagtaatatgacaacctcctctctttcattgggtcaaatgt |
18320195 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 32; Significance: 0.000000004; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 22 - 69
Target Start/End: Complemental strand, 14071602 - 14071555
Alignment:
| Q |
22 |
aagtataggcaagaatggatgtgtggcattaaagctagatatgtcaaa |
69 |
Q |
| |
|
||||| ||||||||| || |||||||| |||||||||||||||||||| |
|
|
| T |
14071602 |
aagtaaaggcaagaaggggtgtgtggcgttaaagctagatatgtcaaa |
14071555 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 22 - 69
Target Start/End: Complemental strand, 14381630 - 14381583
Alignment:
| Q |
22 |
aagtataggcaagaatggatgtgtggcattaaagctagatatgtcaaa |
69 |
Q |
| |
|
||||| ||||||||| || |||||||| |||||||||||||||||||| |
|
|
| T |
14381630 |
aagtaaaggcaagaaggggtgtgtggcgttaaagctagatatgtcaaa |
14381583 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University