View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18475_high_37 (Length: 342)
Name: NF18475_high_37
Description: NF18475
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18475_high_37 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 110; Significance: 2e-55; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 22 - 139
Target Start/End: Original strand, 5781121 - 5781238
Alignment:
| Q |
22 |
ccagttccagttgcattagcattgttcagatctaacgaagcaggtcttcgccgatcttgctttttaaataaagcttcatatctcgatctccgatcttgac |
121 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||| |
|
|
| T |
5781121 |
ccagttccagttgcattagcattgttcagatctaacgaagcaggtcttcgccgatcttgctttttaaataaagattcacatctcgatctccgatcttgac |
5781220 |
T |
 |
| Q |
122 |
attcttcaatccaaatac |
139 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
5781221 |
attcttcaatccaaatac |
5781238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 100; E-Value: 2e-49
Query Start/End: Original strand, 223 - 326
Target Start/End: Original strand, 5781318 - 5781421
Alignment:
| Q |
223 |
ctacctttgagagctagagagaaagagtttctcgcagaatcaaattccgaaagttgatttccgtcttcagaatcaatgtcactatcttccttttgaactg |
322 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
5781318 |
ctacctttgagagctagagagaaagagtttctcgcagaatcaaattccgaaagttgatttccgtctttagaatcaatgtcactatcttccttttgaactg |
5781417 |
T |
 |
| Q |
323 |
tgat |
326 |
Q |
| |
|
|||| |
|
|
| T |
5781418 |
tgat |
5781421 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University