View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18475_high_41 (Length: 333)
Name: NF18475_high_41
Description: NF18475
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18475_high_41 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 231; Significance: 1e-127; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 26 - 311
Target Start/End: Original strand, 13160081 - 13160366
Alignment:
| Q |
26 |
ataaactttataccattttgatgataaaagnnnnnnnnctattgatatgatcatatacnnnnnnnnnaagaaattacgatcatatacttaattaactgtt |
125 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||| | ||||||||||||||||||||||||||||||||| |
|
|
| T |
13160081 |
ataaactttataccattttgatgataaaagaaaaaaaactattgatatgatcatatgctttttttttaagaaattacgatcatatacttaattaactgtt |
13160180 |
T |
 |
| Q |
126 |
ttttatcgtatcagatgctcaaataggaatatgttatggtatgatgggaaacaatctaccaccggcaaacgaggttataaatctctacaaagcaaacaac |
225 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13160181 |
ttttatcgtatcagatgctcaaataggaatatgttatggtatgatgggaaacaatctaccaccggcaaacgaggttataaatctctacaaagcaaacaac |
13160280 |
T |
 |
| Q |
226 |
attaagagaatgagactctacgatcctaatcaagctgctctaaatgcattaagaaattcaggcattgaactcattcttggtgtgcc |
311 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13160281 |
attaagagaatgagactctacgatcctaatcaagctgctctaaatgcattaagaaattcaggcattgaactcattcttggtgtgcc |
13160366 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University