View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18475_high_42 (Length: 332)
Name: NF18475_high_42
Description: NF18475
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18475_high_42 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 292; Significance: 1e-164; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 292; E-Value: 1e-164
Query Start/End: Original strand, 18 - 325
Target Start/End: Original strand, 43856876 - 43857183
Alignment:
| Q |
18 |
ggattggatgctgattctttcaagcttttgtgtggccctcaaacggaaagtctcatttgtcaatagtctggttgtgtggcagtctttctatctagtattt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43856876 |
ggattggatgctgattctttcaagcttttgggtggccctcaaaaggaaagtctcatttgtcaatagtctggttgtgtggcagtctttctatctagtattt |
43856975 |
T |
 |
| Q |
118 |
ataaccataaacattttgcagtctgaatttgttagaataaatcttggagcagaagggtattcttactgatttttcgttataaagatgtagcggcgcaaat |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||| |
|
|
| T |
43856976 |
ataaccataaacattttgcagtctgaatttgttagaataaatcttggagcagaagggtattcttactgatttttcgttaaaaagatgtagcggcgaaaat |
43857075 |
T |
 |
| Q |
218 |
catacaaactatgcgtacgtgttgagatgtgagaaattgtaggttttaagctgcgcccaaacatataaaatatcctgaagcattttaacatgagcagtat |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43857076 |
catacaaactatgcgtacgtgttgagatgtgagaaattgtaggttttaagctgcgcccaaacatataaaatatcctgaagcattttaacatgagcagtat |
43857175 |
T |
 |
| Q |
318 |
ctgtgatg |
325 |
Q |
| |
|
|||||||| |
|
|
| T |
43857176 |
ctgtgatg |
43857183 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University