View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18475_high_44 (Length: 319)
Name: NF18475_high_44
Description: NF18475
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18475_high_44 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 228; Significance: 1e-126; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 12 - 251
Target Start/End: Original strand, 10588731 - 10588970
Alignment:
| Q |
12 |
catcatacttttttcttttgtgatgggtgaaggctcagaaacctaatttctttcttattttaatttttggtggtctagctcgtccgtttgtattgatttt |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
10588731 |
catcatacttttttcttttgtgatgggtgaaggcttagaaacctaatttctttcttattttaatttttggtggtctacctcgtccgtttgtattgatttt |
10588830 |
T |
|
| Q |
112 |
tccacttttcaatgtcactatttccatttatgttctttactcttctttgtgtatttttggacctcttttaagtctctttacacactgggtttgattcgat |
211 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10588831 |
tccacttttcaatgtcactatttccatttctgttctttactcttctttgtgtatttttggacctcttttaagtctctttacacactgggtttgattcgat |
10588930 |
T |
|
| Q |
212 |
cttatttttaatataataattgcttttggaagaaaaagtg |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10588931 |
cttatttttaatataataattgcttttggaagaaaaagtg |
10588970 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 236 - 318
Target Start/End: Original strand, 10588979 - 10589061
Alignment:
| Q |
236 |
tttggaagaaaaagtggcaatgtcatatggggctcgatcatcatagacatcccataatcaaaatgccatggtgcatgttttct |
318 |
Q |
| |
|
|||||||||||||||| |||||||||||||| |||||| ||||||| ||||||||||||||||| |||||||||||||||||| |
|
|
| T |
10588979 |
tttggaagaaaaagtgtcaatgtcatatgggactcgattatcatagtcatcccataatcaaaattccatggtgcatgttttct |
10589061 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University