View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18475_high_45 (Length: 316)
Name: NF18475_high_45
Description: NF18475
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18475_high_45 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 202; Significance: 1e-110; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 1 - 206
Target Start/End: Complemental strand, 44316273 - 44316068
Alignment:
| Q |
1 |
agcaagatctatgaagaagtgattacggacatcaacatagactaaattgacgcaattgcattgtacaaggacagtcactcagcatgtggaaggtatgtgc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44316273 |
agcaagatctatgaagaagtgattacggacatcaacatagactaaattgacgcaattgcattgtacaaggacagtcactcagcatgtggaaggtatgtga |
44316174 |
T |
 |
| Q |
101 |
tgcaaattatgaagttgttgtttaaatgtcaaacaccaattttcaaattagtgactatgatttgttactcttttctcttgtgaattcctgatttcagagg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44316173 |
tgcaaattatgaagttgttgtttaaatgtcaaacaccaattttcaaattagtgactatgatttgttactcttttctcttgtgaattcctgatttcagagg |
44316074 |
T |
 |
| Q |
201 |
aattaa |
206 |
Q |
| |
|
|||||| |
|
|
| T |
44316073 |
aattaa |
44316068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 209 - 298
Target Start/End: Complemental strand, 44316018 - 44315929
Alignment:
| Q |
209 |
aaagaagtaatgtgggtatttcgagtcttgctttgagaggacaatgaattagannnnnnnnctttctccgtagcgttgctatgctcataa |
298 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
44316018 |
aaagaagtaatgtgggtatttcgagtcttgctttgagaggacaatgaattagattttttttctttctccgtagcgttgctatgctcataa |
44315929 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University