View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18475_high_53 (Length: 262)
Name: NF18475_high_53
Description: NF18475
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18475_high_53 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 18 - 251
Target Start/End: Complemental strand, 6307652 - 6307414
Alignment:
| Q |
18 |
tgatttaatcaaataataaagaggtgtaatattagaagaagaaaccctagaatgcatgcaaataagaggatggaaatttttattttgaatacctgatagg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6307652 |
tgatttaatcaaataataaagaggtgtaatattagaagaagaaaccctagaatgcatgcaaataagaggatggaaatttttattttgaatacctgatagg |
6307553 |
T |
 |
| Q |
118 |
tatg-----aatctaattgacattgtagaaatgaatattaatctggaacaattggtaggtaattatattcaaagataaatgtatcgtagggttgtttcct |
212 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6307552 |
tatggtatgaatctaattgacattgtagaaatgaatattaatctggaacaattggtgggtaattatattcaaagataaatgtatcgtagggttgtttcct |
6307453 |
T |
 |
| Q |
213 |
gatcacacaataaggttaggcactatttgcttttgatga |
251 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
6307452 |
gatcacacaataaggttaggcactatttacttttgatga |
6307414 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University