View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18475_high_55 (Length: 247)
Name: NF18475_high_55
Description: NF18475
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18475_high_55 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 1 - 240
Target Start/End: Original strand, 19344679 - 19344918
Alignment:
| Q |
1 |
aaatgagtttgaatcatgggaaagagataagaaatttcaaaagaaaccactgaagttttaccccattgacatggtacatatatattacttcccataaatg |
100 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
19344679 |
aaatgagtttgaatcatgggaaagagagaagaaatttcaaaagaaaccactgaagttttaccccattgacatggtacatatatattacttcccataattg |
19344778 |
T |
|
| Q |
101 |
atgatttatcactcctgtttttggttaaacatatatagcattatggcattgaataggatgatggagttgaagttagacacggggcattaggtcttcgaca |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
19344779 |
atgatttatcactcctgtttttggttaaacatatatagcattatggcattgaataggatgatggagttgaagttagacacggggcattaggtcttcggca |
19344878 |
T |
|
| Q |
201 |
gctggggatagcagcgacacactgtaaacttgagcctatg |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19344879 |
gctggggatagcagcgacacactgtaaacttgagcctatg |
19344918 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University