View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18475_high_66 (Length: 233)
Name: NF18475_high_66
Description: NF18475
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18475_high_66 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 157; Significance: 1e-83; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 1 - 215
Target Start/End: Complemental strand, 8696962 - 8696763
Alignment:
| Q |
1 |
acacaccacttcactcaaataagaaaaacaagcttcttaaaatgggaatttactccaaatcagtattaataatttcttggtatcccatcaaggtgggcaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8696962 |
acacaccacttcactcaaataagaaaaacaagcttcttaaaatgggaatttactccaaatcagtattaataatttcttggtatcccatcaaggtgggcaa |
8696863 |
T |
 |
| Q |
101 |
tctttcttatggatctaatgaatatctattatacattctagatcatggtaatataatgcatgcttaattagcacaataacaccgatgctaatatcagatt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||| || |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8696862 |
tctttcttatggatctaatgaatatctattatatattctacat---------------catgcttaattagcacaataacaccgatgctaatatcagatt |
8696778 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 106; E-Value: 3e-53
Query Start/End: Original strand, 3 - 194
Target Start/End: Original strand, 8677720 - 8677916
Alignment:
| Q |
3 |
acaccacttcactcaaataagaaaaacaagcttcttaaaatgggaatttactccaaatcagtattaataatttcttggtatcccatcaaggtgggcaatc |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||| | ||||| ||||||||||| ||||| |
|
|
| T |
8677720 |
acaccacttcactcaaataagaaaaacaagcttcttaaaatgggaatttactccaaatcagtataaatagtttcctcgtatctcatcaaggtggacaatc |
8677819 |
T |
 |
| Q |
103 |
tttcttatggatctaatgaatatctattatacattctagatcatggtaat-------ataatgcatgcttaattagcacaataacaccgatgctaatat |
194 |
Q |
| |
|
||| |||||||||||||| |||||||||| |||||| ||||||||| | |||||||||||||||||| ||||||||| | ||||||||||| |
|
|
| T |
8677820 |
tttaatatggatctaatgattatctattat--attctacatcatggtactataatgcataatgcatgcttaattaacacaataacgcggatgctaatat |
8677916 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University