View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18475_high_72 (Length: 217)
Name: NF18475_high_72
Description: NF18475
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18475_high_72 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 69; Significance: 4e-31; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 71 - 170
Target Start/End: Original strand, 40375179 - 40375279
Alignment:
| Q |
71 |
cccaaataaagttaaggcagttcataaagctgaaagactcagagcatatacaaaccctcttggttaaaagtttttcttatttacg-atttgttgcaaaat |
169 |
Q |
| |
|
||||| |||| |||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||| | |||||||||||||| |
|
|
| T |
40375179 |
cccaattaaaattaaggcagttcgtaacgctgaaagactcagagcatatacaaaccctcttggttaaaagttttttttatttatgaatttgttgcaaaat |
40375278 |
T |
 |
| Q |
170 |
a |
170 |
Q |
| |
|
| |
|
|
| T |
40375279 |
a |
40375279 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University