View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18475_high_72 (Length: 217)

Name: NF18475_high_72
Description: NF18475
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18475_high_72
NF18475_high_72
[»] chr4 (1 HSPs)
chr4 (71-170)||(40375179-40375279)


Alignment Details
Target: chr4 (Bit Score: 69; Significance: 4e-31; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 71 - 170
Target Start/End: Original strand, 40375179 - 40375279
Alignment:
71 cccaaataaagttaaggcagttcataaagctgaaagactcagagcatatacaaaccctcttggttaaaagtttttcttatttacg-atttgttgcaaaat 169  Q
    ||||| |||| |||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||| | ||||||||||||||    
40375179 cccaattaaaattaaggcagttcgtaacgctgaaagactcagagcatatacaaaccctcttggttaaaagttttttttatttatgaatttgttgcaaaat 40375278  T
170 a 170  Q
    |    
40375279 a 40375279  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University