View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18475_low_25 (Length: 389)
Name: NF18475_low_25
Description: NF18475
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18475_low_25 |
 |  |
|
| [»] scaffold0178 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0178 (Bit Score: 243; Significance: 1e-134; HSPs: 1)
Name: scaffold0178
Description:
Target: scaffold0178; HSP #1
Raw Score: 243; E-Value: 1e-134
Query Start/End: Original strand, 13 - 375
Target Start/End: Original strand, 18637 - 19007
Alignment:
| Q |
13 |
ttcttcttctcatcatcacctgcaaaaataagaaatctgcaatttgaactttttaaagattatgtcatatttggtnnnnnnngaaaataatttccatgga |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||| |
|
|
| T |
18637 |
ttcttcttctcatcatcacctgcaaaaataagaaatctgcaatttgaactttttaacgattatgtcatatttggtaaaaaaagaaaataatttccatgga |
18736 |
T |
 |
| Q |
113 |
tgacccaatttgtgtggttgtaaaaaatcatttcaatggttctgttattatagtggtttcgatgtgggggaatgggtgacccagttt------------- |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18737 |
tgacccaatttgtgtggttgtaaaaaatcatttcaatggttctgctattgtagtggtttcgatgtgggggaatgggtgacccagttttgcaactaactct |
18836 |
T |
 |
| Q |
200 |
---tgcatactctctatttttatcagtttgcaagactaacaacattactcccatttatgttaaaaagatatgtatcacaatggataatggattatgttgt |
296 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| | | ||||||||||||| |
|
|
| T |
18837 |
ttatgcatactctctatttttatcagtttgcaagactaacaacactactcccatttatgttaaaaagatatgtatcgc-------agtggattatgttgt |
18929 |
T |
 |
| Q |
297 |
tgaagctttgatgtggttgtaatgggtgaccccaatttgtgtggttgtaaaggatgggaggatcctattatgttattga |
375 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
18930 |
tgaagctttgatgtggttgtaatgggtga-cccaatttgtgtggttgtaaaggatgggaggatcctgttatgttattga |
19007 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University