View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18475_low_32 (Length: 370)
Name: NF18475_low_32
Description: NF18475
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18475_low_32 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 206; Significance: 1e-112; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 206; E-Value: 1e-112
Query Start/End: Original strand, 43 - 277
Target Start/End: Complemental strand, 16703813 - 16703583
Alignment:
| Q |
43 |
caaaaatgacctttgtgtaaaatgtattaattttggattcttttgaatattcttgacagtgtgtttcattcatatgtcggtactcggaaggaaatttcaa |
142 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||| |
|
|
| T |
16703813 |
caaaaatgacctttgtgtaaaatgtattaattttggattcttttgaatattcttgacagtgtgtttcat----atgtcggtactcggtaggaaatttcaa |
16703718 |
T |
|
| Q |
143 |
atttggattggcatgtgcatctatcgtgactgaatgttacatcgtacttcatcgttttctttcccccgacatcatatgcatgaaataacaatgaacaatc |
242 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||| |
|
|
| T |
16703717 |
atttggattggcatgtgcatctatcgtgactgaatgttacatcgtacttcatcgttttctttctcccgacattatatgcatgaaataacaatgaacaatc |
16703618 |
T |
|
| Q |
243 |
gctagtgtctctctaataaaccaggaacatgatgt |
277 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
16703617 |
gctagtgtctctctaataaaccaggaacatgatgt |
16703583 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 291 - 355
Target Start/End: Complemental strand, 16703522 - 16703458
Alignment:
| Q |
291 |
ataactcataattaccactatcatcaacatactctgatctcaaatactacaagcagggaaaaaat |
355 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16703522 |
ataactcataattaccactatcatcaacatactctgatctcaaatactacaagcagggaaaaaat |
16703458 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 1 - 47
Target Start/End: Complemental strand, 16703894 - 16703848
Alignment:
| Q |
1 |
aacatgtagattgtagagcatagtcgttttgaatgagaagtccaaaa |
47 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| || ||||||||| |
|
|
| T |
16703894 |
aacatgtagattgtcgagcatagtcgttttgaataagtagtccaaaa |
16703848 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University