View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18475_low_38 (Length: 337)
Name: NF18475_low_38
Description: NF18475
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18475_low_38 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 279; Significance: 1e-156; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 279; E-Value: 1e-156
Query Start/End: Original strand, 19 - 330
Target Start/End: Original strand, 33033191 - 33033502
Alignment:
| Q |
19 |
tttctctacggagagagatagaaattatgattctctgatttttctaggttttggttgaatcaatctttctaattgaagatggaggtttagagaacctttt |
118 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33033191 |
tttctctacggagagagatagagattatgattctctgatttttctaggttttggttgaatcaatctttctaattgaagatggaggtttagagaacctttt |
33033290 |
T |
 |
| Q |
119 |
cctttacggcattgtcttgtgtttcgagattgcggcgttgttggagccgttacaaccgtgaatttgggattaattttttagggtttctagaactgaggga |
218 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33033291 |
cttttacggcattgtcttgtgtttcgagattgcggcgttgttggagccgttacaaccgtgaatttgggattaattttttagggtttctagaactgaggga |
33033390 |
T |
 |
| Q |
219 |
aaatgaggggtgaatagtttaggttagtattcagagtataacaacggtgttgttttagggttgggggtggtgaaggtggttctgcannnnnnngggttga |
318 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
33033391 |
aaatgaggggtgaatagtttaggttagtattcagagtataacagcggtgttgttttagggttgggggtggtgaaggtggttctgcatttttttgggttga |
33033490 |
T |
 |
| Q |
319 |
ttctgatgatgt |
330 |
Q |
| |
|
|||||||||||| |
|
|
| T |
33033491 |
ttctgatgatgt |
33033502 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University