View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18475_low_61 (Length: 239)
Name: NF18475_low_61
Description: NF18475
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18475_low_61 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 110; Significance: 1e-55; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 110; E-Value: 1e-55
Query Start/End: Original strand, 102 - 223
Target Start/End: Complemental strand, 19344469 - 19344348
Alignment:
| Q |
102 |
aatgtcaataaggttgtaaccaaaaaataaatgtcaataaggactaaagctgcaattgatcttgttagtattattactcattaagttttctcccttggtc |
201 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19344469 |
aatgtcaataaggttgtaaccaaaaaacaaatgtcaataaggactaaagctgcaattgatcttgttagtattattactcattaagttttctcccttggtc |
19344370 |
T |
 |
| Q |
202 |
acaaacagagaaggcacagttg |
223 |
Q |
| |
|
||||| ||||||||||||||| |
|
|
| T |
19344369 |
acaaagggagaaggcacagttg |
19344348 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 4 - 103
Target Start/End: Complemental strand, 19344596 - 19344497
Alignment:
| Q |
4 |
ttggatcgtcccccactcttcctttcttgaaatacaaatgcaaagaattctctgggacgacaatcagttgcatgacacagtagctgccccaaattaacaa |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19344596 |
ttggatcgtcccccactcttcctttcttgaaatacaaatgcaaagaattctctgggacgacaatcagttgcatgacacagtagctgccccaaattaacaa |
19344497 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University