View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18476_low_5 (Length: 219)
Name: NF18476_low_5
Description: NF18476
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18476_low_5 |
 | |
|
| [»] chr8 (2 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 185; Significance: 1e-100; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 19 - 219
Target Start/End: Original strand, 22213046 - 22213246
Alignment:
| Q |
19 |
gaagtcgctgctcccccaggtcctggtgctggaggaccacctgctgcggtagatggaccacctgctggtgaaagagctggtggtccacctgccggagaag |
118 |
Q |
| |
|
|||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22213046 |
gaagtcgctgctccaccaggtcctggtgccggaggaccacctgctgcggtagatggaccacctgctggtgaaagagctggtggtccacctgccggagaag |
22213145 |
T |
|
| Q |
119 |
gagatgaagccataggtccaccagctggaggtgtgctgacaactggagaaggagatgatgccgtaggtccaccagccggtggtgtgctcactactggaga |
218 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22213146 |
gagatgaagccataggtccaccagccggaggtgtgctgacaactggagaaggagatgatgccataggtccaccagccggtggtgtgctcactactggaga |
22213245 |
T |
|
| Q |
219 |
t |
219 |
Q |
| |
|
| |
|
|
| T |
22213246 |
t |
22213246 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 112 - 185
Target Start/End: Original strand, 22213190 - 22213263
Alignment:
| Q |
112 |
ggagaaggagatgaagccataggtccaccagctggaggtgtgctgacaactggagaaggagatgatgccgtagg |
185 |
Q |
| |
|
|||||||||||||| ||||||||||||||||| || |||||||| || |||||||| ||||||||||||||||| |
|
|
| T |
22213190 |
ggagaaggagatgatgccataggtccaccagccggtggtgtgctcactactggagatggagatgatgccgtagg |
22213263 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University