View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18477_high_5 (Length: 242)
Name: NF18477_high_5
Description: NF18477
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18477_high_5 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 1 - 229
Target Start/End: Complemental strand, 40736281 - 40736051
Alignment:
| Q |
1 |
tcatcaactatacgataggaataacagcaaatacaagcacatccttctccgacatgcccattttttctttcaattcggtacctctatattattttttctg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40736281 |
tcatcaactatacgataggaataacagcaaatacaagcacatccttctccgacatgcccattttttctttcaattcggtacctctatattattttttctg |
40736182 |
T |
|
| Q |
101 |
atgtaaccttgcaaatcctcgcaggtat--acacgccctaagctatatgtctgaagttttccttgagtacattttttgtaacccttttataactgagttc |
198 |
Q |
| |
|
|||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40736181 |
atgtaaccttgcaagtcctcgcaggtatacacacgccctaagctatatgtctgaagttttccttgagtacattttttgtaacccttttataactgagttc |
40736082 |
T |
|
| Q |
199 |
tacttcggtgtaaccggcccgtagctaatga |
229 |
Q |
| |
|
||||||||||||||||||||||| ||||||| |
|
|
| T |
40736081 |
tacttcggtgtaaccggcccgtaactaatga |
40736051 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University